Stem-loop sequence pmi-mir-92c

AccessionMI0025101 (change log)
DescriptionPatiria miniata miR-92c stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   gucagaaaucuca    a g    acc   g      uuuu    c  guccaa 
5'              ggug u gcgc   ggc gggaca    caau cu      g
                |||| | ||||   ||| ||||||    |||| ||      a
3'              ucac a cgcg   ccg cccugu    guua ga      c
   ------ucacgaa    - g    --a   g      ucac    u  acuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-92c-3p

Accession MIMAT0032153
Sequence

66 - 

uauugcacuugucccggccag

 - 86

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).