Stem-loop sequence pmi-mir-31-1

AccessionMI0025093 (change log)
DescriptionPatiria miniata miR-31-1 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   --    u g   a     g    u  c       uu   gc 
5'   agug a aaa ggcaa augu gg auagcug  guu  c
     |||| | ||| ||||| |||| || |||||||  |||  a
3'   ucac u uuu ccguu uaca cc ugucgac  caa  a
   gu    c g   a     a    u  a       --   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-31-5p

Accession MIMAT0032147
Sequence

11 - 

aggcaagauguuggcauagcu

 - 31

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).