Stem-loop sequence pmi-mir-9

AccessionMI0025088 (change log)
DescriptionPatiria miniata miR-9 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   -    ga    a  c        u        g     -   guc 
5'  aggc  ugca uu ucuuuggu aucuagcu uauga gug   a
    ||||  |||| || |||||||| |||||||| ||||| |||    
3'  ucug  augu aa agaaacca uggaucga auacu cgc   u
   g    --    g  u        u        a     a   auc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-9-5p

Accession MIMAT0032142
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).