Stem-loop sequence pmi-mir-7

AccessionMI0025087 (change log)
DescriptionPatiria miniata miR-7 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   uuauucu       c     -   a    u           u   guaa  a 
5'        gccgguc cccca ugg agac agugauuuugu guu    uc a
          ||||||| ||||| ||| |||| ||||||||||| |||    ||  
3'        cggucgg ggggu acc ucug ucacuaaaaua caa    ag a
   ------c       u     c   g    -           -   ---a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-7-5p

Accession MIMAT0032141
Sequence

21 - 

uggaagacuagugauuuuguugu

 - 43

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).