Stem-loop sequence pmi-mir-1

AccessionMI0025086 (change log)
DescriptionPatiria miniata miR-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   ---------------         c    u        --     u 
5'                acaugcuuc uuac auuccaua  guuau c
                  ||||||||| |||| ||||||||  ||||| u
3'                uguaugaag aaug uaagguau  cgaua c
   ccggggucauaguua         a    -        ac     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-1-3p

Accession MIMAT0032140
Sequence

43 - 

uggaauguaaagaaguauguau

 - 64

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).