Stem-loop sequence mdo-mir-7301

AccessionMI0025045 (change log)
DescriptionMonodelphis domestica miR-7301 stem-loop
Stem-loop
   --      auc      -    u   a  ag 
5'   uuccua   ccccug caug uug au  c
     ||||||   |||||| |||| ||| ||   
3'   gagggu   ggggac guac aau ua  u
   ug      cgc      c    c   c  gg 
Get sequence
Deep sequencing
4328 reads, 40 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 384562205-384562265 [-]
sense
ENSMODT00000009662 ; AKT2-201; intron 2
Database links

Mature sequence mdo-miR-7301-5p

Accession MIMAT0029914
Sequence

1 - 

uuccuaaucccccugcauguuu

 - 22

Get sequence
Deep sequencing4175 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mdo-miR-7301-3p

Accession MIMAT0029915
Sequence

39 - 

ccaugccaggggcgcugggaggu

 - 61

Get sequence
Deep sequencing150 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).