Stem-loop sequence mml-mir-5697

AccessionMI0025044 (change log)
DescriptionMacaca mulatta miR-5697 stem-loop
Gene family MIPF0001748; mir-5697
Stem-loop
   --           u          g  ugg 
5'   aaguaguuuca gauaaagggu ug   g
     ||||||||||| |||||||||| ||    
3'   uucgucaaagu cuauuuucca ac   a
   ag           -          -  ugg 
Get sequence
Deep sequencing
93 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 9170229-9170286 [+]
intergenic
Database links

Mature sequence mml-miR-5697-5p

Accession MIMAT0029912
Sequence

1 - 

aaguaguuucaugauaaagggu

 - 22

Get sequence
Deep sequencing88 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-5697-3p

Accession MIMAT0029913
Sequence

38 - 

cuuuuaucugaaacugcuuga

 - 58

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).