Stem-loop sequence mmu-mir-7243

AccessionMI0025043 (change log)
Symbol MGI:Mir7243
DescriptionMus musculus miR-7243 stem-loop
Stem-loop
   --                    -  u 
5'   ugcugucagcuguucugagu gc a
     |||||||||||||||||||| || a
3'   acgacagucgacaagacuca cg a
   ug                    a  a 
Get sequence
Deep sequencing
44 reads, 5.88 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 102304924-102304975 [-]
sense
OTTMUST00000049888 ; Ephb1-001; intron 1
OTTMUST00000049891 ; Ephb1-003; intron 1
OTTMUST00000049890 ; Ephb1-002; intron 1
ENSMUST00000035129 ; Ephb1-001; intron 1
ENSMUST00000085169 ; Ephb1-003; intron 1
ENSMUST00000149800 ; Ephb1-002; intron 1
Database links

Mature sequence mmu-miR-7243-5p

Accession MIMAT0029910
Sequence

1 - 

ugcugucagcuguucugagu

 - 20

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7243-3p

Accession MIMAT0029911
Sequence

33 - 

ucagaacagcugacagcagu

 - 52

Get sequence
Deep sequencing44 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).