Stem-loop sequence mmu-mir-1258

AccessionMI0025040 (change log)
Symbol MGI:Mir1258
DescriptionMus musculus miR-1258 stem-loop
Stem-loop
   ---                       uaug 
5'    ugcugagcuaauucccuaacugc    u
      |||||||||||||||||||||||    g
3'    acgacucgauuaagggauugacg    g
   aug                       ucga 
Get sequence
Deep sequencing
172 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 56538139-56538198 [+]
antisense
OTTMUST00000089713 ; Aldh7a1-006; intron 5
OTTMUST00000096280 ; Aldh7a1-007; intron 10
OTTMUST00000089709 ; Aldh7a1-002; intron 10
OTTMUST00000096281 ; Aldh7a1-008; intron 10
OTTMUST00000089708 ; Aldh7a1-001; intron 12
ENSMUST00000170309 ; Aldh7a1-006; intron 5
ENSMUST00000172734 ; Aldh7a1-007; intron 10
ENSMUST00000066208 ; Aldh7a1-002; intron 10
ENSMUST00000174704 ; Aldh7a1-008; intron 10
ENSMUST00000174518 ; Aldh7a1-001; intron 12
Database links

Mature sequence mmu-miR-1258-5p

Accession MIMAT0029904
Sequence

1 - 

ugcugagcuaauucccuaacug

 - 22

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-1258-3p

Accession MIMAT0029905
Sequence

39 - 

uuagggaauuagcucagcagua

 - 60

Get sequence
Deep sequencing166 reads, 43 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1