Stem-loop sequence mmu-mir-290b

AccessionMI0025038 (change log)
Symbol MGI:Mir290b
DescriptionMus musculus miR-290b stem-loop
Literature search

53 open access papers mention mmu-mir-290b
(419 sentences)

Stem-loop
   -       a   -  c          aaa 
5'  gcuuaaa cua gg ggcacuuuuu   g
    ||||||| ||| || ||||||||||   a
3'  ugaguuu gau cc ccgugaaaaa   a
   a       -   a  c          aaa 
Get sequence
Deep sequencing
89 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 3218638-3218695 [-]
antisense
ENSMUST00000104627 ; Mir290-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-290b
mmu-mir-295chr7: 3220773-3220841 [+]
mmu-mir-294chr7: 3220641-3220724 [+]
mmu-mir-293chr7: 3220343-3220422 [+]
mmu-mir-291bchr7: 3219482-3219560 [+]
mmu-mir-292bchr7: 3219198-3219259 [-]
mmu-mir-292achr7: 3219189-3219270 [+]
mmu-mir-291achr7: 3218919-3219000 [+]
mmu-mir-290bchr7: 3218638-3218695 [-]
mmu-mir-290achr7: 3218626-3218708 [+]
Database links

Mature sequence mmu-miR-290b-5p

Accession MIMAT0029900
Sequence

1 - 

gcuuaaaacuaggcggcacuuu

 - 22

Get sequence
Deep sequencing28 reads, 5 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-290b-3p

Accession MIMAT0029901
Sequence

37 - 

aagugcccccauaguuugagua

 - 58

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1