Stem-loop sequence mmu-mir-126b

AccessionMI0025035 (change log)
Symbol MGI:Mir126b
DescriptionMus musculus miR-126b stem-loop
Gene family MIPF0000115; mir-126
Literature search

200 open access papers mention mmu-mir-126b
(1691 sentences)

Stem-loop
   ---         cac      a   -   a 
5'    auuauuacu   gguacg guu uga g
      |||||||||   |||||| ||| |||  
3'    uaauaauga   ccaugc cga acu u
   gug         aaa      g   c   g 
Get sequence
Deep sequencing
56 reads, 3.45 reads per million, 29 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 26591363-26591420 [-]
antisense
OTTMUST00000027061 ; Egfl7-007; intron 1
OTTMUST00000098442 ; Egfl7-016; intron 1
OTTMUST00000098446 ; RP23-125H15.6-001; intron 3
OTTMUST00000027062 ; Egfl7-008; exon 4
OTTMUST00000027059 ; Egfl7-005; intron 6
OTTMUST00000098440 ; Egfl7-014; intron 6
OTTMUST00000027055 ; Egfl7-001; intron 7
OTTMUST00000027056 ; Egfl7-002; intron 7
OTTMUST00000027057 ; Egfl7-003; intron 7
OTTMUST00000078275 ; Egfl7-011; intron 7
ENSMUST00000131112 ; Egfl7-007; intron 1
ENSMUST00000174656 ; Egfl7-016; intron 1
ENSMUST00000083606 ; Mir126-201; exon 1
ENSMUST00000174066 ; Gm20532-001; intron 3
ENSMUST00000147351 ; Egfl7-008; exon 4
ENSMUST00000174211 ; Egfl7-005; intron 6
ENSMUST00000150404 ; Egfl7-014; intron 6
ENSMUST00000166920 ; Egfl7-001; intron 7
ENSMUST00000100290 ; Egfl7-002; intron 7
ENSMUST00000102907 ; Egfl7-003; intron 7
ENSMUST00000139801 ; Egfl7-011; intron 7
Clustered miRNAs
< 10kb from mmu-mir-126b
mmu-mir-126bchr2: 26591363-26591420 [-]
mmu-mir-126achr2: 26591357-26591429 [+]
Database links

Mature sequence mmu-miR-126b-5p

Accession MIMAT0029894
Sequence

1 - 

auuauuacucacgguacgaguu

 - 22

Get sequence
Deep sequencing14 reads, 6 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-126b-3p

Accession MIMAT0029895
Sequence

36 - 

cgcguaccaaaaguaauaaugug

 - 58

Get sequence
Deep sequencing40 reads, 27 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1