Stem-loop sequence mmu-mir-129b

AccessionMI0025019 (change log)
Symbol MGI:Mir129b
DescriptionMus musculus miR-129b stem-loop
Gene family MIPF0000073; mir-129
Literature search

51 open access papers mention mmu-mir-129b
(507 sentences)

Stem-loop
   --g       g   aa      c --g  uauu 
5'    cuuuuug ggu  gggcuu c   gc    g
      ||||||| |||  |||||| |   ||    a
3'    gaaaaac cca  cccgaa g   ug    g
   uua       g   ga      c aca  uauu 
Get sequence
Deep sequencing
148 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 94241378-94241442 [+]
antisense
ENSMUST00000083577 ; Mir129-2-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-129b
mmu-mir-129-2chr2: 94241364-94241453 [-]
mmu-mir-129bchr2: 94241378-94241442 [+]
Database links

Mature sequence mmu-miR-129b-5p

Accession MIMAT0029862
Sequence

1 - 

gcuuuuugggguaagggcuucc

 - 22

Get sequence
Deep sequencing76 reads, 14 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-129b-3p

Accession MIMAT0029863
Sequence

43 - 

caagcccagaccgcaaaaagauu

 - 65

Get sequence
Deep sequencing70 reads, 15 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1