Stem-loop sequence mmu-mir-7673

AccessionMI0025013 (change log)
Symbol MGI:Mir7673
DescriptionMus musculus miR-7673 stem-loop
Stem-loop
   ---      u a                u  a 
5'    uuugac g gagguaaggaaugagu au c
      |||||| | |||||||||||||||| || u
3'    aaacug c cuccauuccuuacuca ug g
   agg      c a                u  u 
Get sequence
Deep sequencing
104 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 94274574-94274637 [+]
sense
OTTMUST00000043655 ; Klhl15-001; exon 4
ENSMUST00000113915 ; Klhl15-001; exon 4
Database links

Mature sequence mmu-miR-7673-5p

Accession MIMAT0029852
Sequence

1 - 

uuugacugagagguaaggaaug

 - 22

Get sequence
Deep sequencing86 reads, 37 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7673-3p

Accession MIMAT0029853
Sequence

42 - 

uuccuuaccucaccgucaaagga

 - 64

Get sequence
Deep sequencing11 reads, 10 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1