Stem-loop sequence mmu-mir-7670

AccessionMI0025010 (change log)
Symbol MGI:Mir7670
DescriptionMus musculus miR-7670 stem-loop
Stem-loop
   -auu      gg    uu       ---a   uuu 
5'     cagaug  caga  gggaagu    guc   g
       ||||||  ||||  |||||||    |||   c
3'     gucuau  gucu  cccuucg    uag   a
   agau      aa    uu       gucg   uac 
Get sequence
Deep sequencing
201 reads, 0 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 38507325-38507393 [+]
sense
OTTMUST00000087010 ; Ubn2-004; intron 1
OTTMUST00000087009 ; Ubn2-003; intron 14
OTTMUST00000087007 ; Ubn2-001; exon 17
ENSMUST00000159447 ; Ubn2-004; intron 1
ENSMUST00000162593 ; Ubn2-003; intron 14
ENSMUST00000160583 ; Ubn2-001; exon 17
Database links

Mature sequence mmu-miR-7670-5p

Accession MIMAT0029846
Sequence

1 - 

auucagaugggcagauugggaa

 - 22

Get sequence
Deep sequencing169 reads, 34 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7670-3p

Accession MIMAT0029847
Sequence

47 - 

uucccuuucugaauaucuguaga

 - 69

Get sequence
Deep sequencing32 reads, 23 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1