Stem-loop sequence mmu-mir-7655

AccessionMI0024995 (change log)
Symbol MGI:Mir7655
DescriptionMus musculus miR-7655 stem-loop
Stem-loop
   -c            -  cuaa       cc 
5'   ggcccacggagc uc    agacucg  c
     |||||||||||| ||    |||||||   
3'   ccgggugccucg ag    uuugggc  u
   gu            c  --ua       cg 
Get sequence
Deep sequencing
140 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 18057846-18057903 [+]
sense
ENSMUST00000028076 ; Mllt10-201; intron 1
Database links

Mature sequence mmu-miR-7655-5p

Accession MIMAT0029816
Sequence

1 - 

cggcccacggagcuccuaaaga

 - 22

Get sequence
Deep sequencing65 reads, 22 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7655-3p

Accession MIMAT0029817
Sequence

37 - 

uuuaugacgcuccgugggccug

 - 58

Get sequence
Deep sequencing73 reads, 36 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1