Stem-loop sequence mmu-mir-7653

AccessionMI0024993 (change log)
Symbol MGI:Mir7653
DescriptionMus musculus miR-7653 stem-loop
Literature search

1 open access papers mention mmu-mir-7653
(2 sentences)

Stem-loop
   -uaa    c   -   ac  ac    ---g  a 
5'     gggg gga cag  ag  ggca    ga g
       |||| ||| |||  ||  ||||    ||  
3'     cccc ccu guc  uc  ccgu    cu g
   uccg    a   u   -a  -c    acga  g 
Get sequence
Deep sequencing
193 reads, 0 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 78178827-78178887 [+]
sense
OTTMUST00000000314 ; Tlcd1-002; intron 1
OTTMUST00000000315 ; Tlcd1-003; intron 1
OTTMUST00000000319 ; Tlcd1-007; 3'UTR (exon 1)
OTTMUST00000000313 ; Tlcd1-001; 3'UTR (exon 1)
OTTMUST00000000317 ; Tlcd1-005; exon 1
OTTMUST00000000316 ; Tlcd1-004; 3'UTR (exon 1)
OTTMUST00000000320 ; Tlcd1-008; 3'UTR (exon 2)
ENSMUST00000147819 ; Tlcd1-002; intron 1
ENSMUST00000145507 ; Tlcd1-003; intron 1
ENSMUST00000092880 ; Tlcd1-007; 3'UTR (exon 1)
ENSMUST00000127587 ; Tlcd1-001; 3'UTR (exon 1)
ENSMUST00000141578 ; Tlcd1-005; exon 1
ENSMUST00000108338 ; Tlcd1-004; 3'UTR (exon 1)
ENSMUST00000098545 ; Tlcd1-008; 3'UTR (exon 2)
Database links

Mature sequence mmu-miR-7653-5p

Accession MIMAT0029812
Sequence

1 - 

uaaggggcggacagacagacgg

 - 22

Get sequence
Deep sequencing170 reads, 39 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7653-3p

Accession MIMAT0029813
Sequence

40 - 

ccccuacuguuccaccccgccu

 - 61

Get sequence
Deep sequencing21 reads, 9 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1