Stem-loop sequence mmu-mir-7652

AccessionMI0024992 (change log)
Symbol MGI:Mir7652
DescriptionMus musculus miR-7652 stem-loop
Literature search

1 open access papers mention mmu-mir-7652
(1 sentences)

Stem-loop
   ua   g        uu         ug 
5'   agg cacaggga  ucaggcaug  c
     ||| ||||||||  |||||||||   
3'   uuc guguccuu  ggucuguac  c
   uc   g        uc         ca 
Get sequence
Deep sequencing
147 reads, 22.4 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 55501226-55501281 [+]
sense
OTTMUST00000012673 ; G3bp1-001; exon 12
ENSMUST00000018727 ; G3bp1-001; exon 12
Database links

Mature sequence mmu-miR-7652-5p

Accession MIMAT0029810
Sequence

1 - 

uaagggcacagggauuucaggc

 - 22

Get sequence
Deep sequencing88 reads, 29 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7652-3p

Accession MIMAT0029811
Sequence

36 - 

ucuggcuuuccuguggcuucu

 - 56

Get sequence
Deep sequencing35 reads, 25 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1