Stem-loop sequence mmu-mir-7036b

AccessionMI0024991 (change log)
Symbol MGI:Mir7036b
DescriptionMus musculus miR-7036b stem-loop
Literature search

2 open access papers mention mmu-mir-7036b
(5 sentences)

Stem-loop
   ---a g        u   u      ----    u 
5'     c cgggguuc cug ggaagc    ggcu g
       | |||||||| ||| ||||||    |||| c
3'     g gcuccggg ggu ccuucg    ucgg u
   ccug g        u   -      aguc    c 
Get sequence
Deep sequencing
223 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 34574151-34574213 [+]
sense
OTTMUST00000055785 ; Add1-001; intron 1
OTTMUST00000055852 ; Add1-007; intron 1
OTTMUST00000055854 ; Add1-009; intron 1
OTTMUST00000055853 ; Add1-008; intron 1
OTTMUST00000055786 ; Add1-002; intron 1
OTTMUST00000055850 ; Add1-005; intron 1
OTTMUST00000055787 ; Add1-003; 3'UTR (exon 1)
ENSMUST00000114338 ; Add1-001; intron 1
ENSMUST00000147574 ; Add1-007; intron 1
ENSMUST00000146295 ; Add1-009; intron 1
ENSMUST00000145986 ; Add1-008; intron 1
ENSMUST00000001108 ; Add1-002; intron 1
ENSMUST00000114340 ; Add1-005; intron 1
ENSMUST00000114335 ; Add1-003; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-7036b-5p

Accession MIMAT0029808
Sequence

1 - 

acgcgggguucucuguggaagc

 - 22

Get sequence
Deep sequencing213 reads, 40 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7036b-3p

Accession MIMAT0029809
Sequence

42 - 

uuccuggugggccucggggucc

 - 63

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1