Stem-loop sequence mmu-mir-219b

AccessionMI0024990 (change log)
Symbol MGI:Mir219b
DescriptionMus musculus miR-219b stem-loop
Gene family MIPF0000044; mir-219
Literature search

48 open access papers mention mmu-mir-219b
(442 sentences)

Stem-loop
   --a   -      c a       ------------   u 
5'    gau guccag c caauucu            cgg u
      ||| |||||| | |||||||            |||  
3'    cua cagguu g guuaaga            gcc g
   uga   a      u c       acaugcucagac   g 
Get sequence
Deep sequencing
190 reads, 0 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 29845647-29845711 [+]
antisense
ENSMUST00000083551 ; Mir219-2-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-219b
mmu-mir-219a-2chr2: 29845631-29845727 [-]
mmu-mir-219bchr2: 29845647-29845711 [+]
Database links

Mature sequence mmu-miR-219b-5p

Accession MIMAT0029806
Sequence

1 - 

agauguccagccacaauucucg

 - 22

Get sequence
Deep sequencing13 reads, 9 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-219b-3p

Accession MIMAT0029807
Sequence

43 - 

agaauugcguuuggacaaucagu

 - 65

Get sequence
Deep sequencing175 reads, 52 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1