Stem-loop sequence mmu-mir-7651

AccessionMI0024989 (change log)
Symbol MGI:Mir7651
DescriptionMus musculus miR-7651 stem-loop
Stem-loop
   --   u     ---     c        c      
5'   aag ggaaa   gccag cugagaug auugu 
     ||| |||||   ||||| |||||||| |||| g
3'   uuc ccuuu   ugguu gacucugu uaaua 
   ag   c     uuu     u        c      
Get sequence
Deep sequencing
166 reads, 0 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 6401630-6401693 [+]
sense
OTTMUST00000001532 ; Zmiz2-005; intron 11
OTTMUST00000001531 ; Zmiz2-004; intron 13
OTTMUST00000001528 ; Zmiz2-001; intron 14
OTTMUST00000001529 ; Zmiz2-002; intron 14
OTTMUST00000001530 ; Zmiz2-003; intron 15
ENSMUST00000109785 ; Zmiz2-005; intron 11
ENSMUST00000102914 ; Zmiz2-004; intron 13
ENSMUST00000109787 ; Zmiz2-002; intron 14
ENSMUST00000012612 ; Zmiz2-001; intron 14
ENSMUST00000109786 ; Zmiz2-003; intron 15
Database links

Mature sequence mmu-miR-7651-5p

Accession MIMAT0029804
Sequence

1 - 

aaguggaaagccagccugagau

 - 22

Get sequence
Deep sequencing160 reads, 53 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7651-3p

Accession MIMAT0029805
Sequence

41 - 

ucaguuugguuuuuuuccccuuga

 - 64

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1