Stem-loop sequence mmu-mir-6546

AccessionMI0024983 (change log)
Symbol MGI:Mir6546
DescriptionMus musculus miR-6546 stem-loop
Stem-loop
   --a     cuc  a    g       ---   ca 
5'    ggcgc   ug gcuu ugcuugu   cgc  g
      |||||   || |||| |||||||   |||   
3'    ccgcg   ac cgaa gcgagcg   gcg  g
   aga     --a  c    -       auc   uc 
Get sequence
Deep sequencing
1011 reads, 0 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 171064591-171064652 [-]
sense
OTTMUST00000089521 ; Fcgr3-004; intron 1
ENSMUST00000164179 ; Fcgr3-004; intron 1
Database links

Mature sequence mmu-miR-6546-5p

Accession MIMAT0029792
Sequence

1 - 

aggcgccucugagcuugugcuugu

 - 24

Get sequence
Deep sequencing828 reads, 52 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-6546-3p

Accession MIMAT0029793
Sequence

42 - 

gagcgaagcccaagcgccaga

 - 62

Get sequence
Deep sequencing179 reads, 40 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1