Stem-loop sequence cbn-mir-79-1

AccessionMI0024927 (change log)
DescriptionCaenorhabditis brenneri miR-79-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --          uc       a   --uu    au 
5'   cuuuggugau  aguuuua uga    gacg  u
     ||||||||||  ||||||| |||    ||||   
3'   gaaaccauug  ucgaaau acu    uugc  c
   uc          ga       -   ucuu    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig15: 169202-169268 [-]
intergenic
Database links

Mature sequence cbn-miR-79

Accession MIMAT0029748
Sequence

46 - 

auaaagcuagguuaccaaagcu

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1