Stem-loop sequence cbn-mir-52-1

AccessionMI0024833 (change log)
DescriptionCaenorhabditis brenneri miR-52-1 stem-loop
Gene family MIPF0000160; mir-52
Stem-loop
   -c       c  a   uuc    c    caa 
5'   acccgua au ugu   cgug uuga   u
     ||||||| || |||   |||| ||||    
3'   uggguau ua aca   gcac aacu   g
   gc       u  -   -cu    u    uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig147: 145718-145778 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-52-1
cbn-mir-52-1Cbre_Contig147: 145718-145778 [+]
cbn-mir-51-1Cbre_Contig147: 149716-149777 [+]
Database links

Mature sequence cbn-miR-52

Accession MIMAT0029686
Sequence

1 - 

cacccguacauauguuuccgugcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1