Stem-loop sequence crm-mir-51-1

AccessionMI0024775 (change log)
Previous IDscrm-mir-51
DescriptionCaenorhabditis remanei miR-51-1 stem-loop
Gene family MIPF0000268; mir-51
Stem-loop
   --    c   g uc  a       -    agc 
5'   uacc gua c  cu uccaugu uacu   a
     |||| ||| |  || ||||||| ||||   g
3'   gugg cau g  ga agguaca guga   a
   au    a   g uu  -       a    gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig1341: 3371-3433 [+]
intergenic
Clustered miRNAs
< 10kb from crm-mir-51-1
crm-mir-52-1Crem_Contig1341: 55-147 [+]
crm-mir-51-1Crem_Contig1341: 3371-3433 [+]
Database links

Mature sequence crm-miR-51

Accession MIMAT0029636
Sequence

1 - 

uacccguagcuccuauccauguu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1