Stem-loop sequence cbr-mir-2

AccessionMI0024743 (change log)
DescriptionCaenorhabditis briggsae miR-2 stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention cbr-mir-2
(5 sentences)

Stem-loop
   --c        -    g    u    --   cauaagu        u 
5'    cgucaaag uggu ugug uaug  ccg       gaacuucu u
      |||||||| |||| |||| ||||  |||       ||||||||  
3'    guaguuuc accg acac auac  ggu       uuugaagg u
   cgu        g    -    u    uu   -------        c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrI: 2714104-2714186 [-]
intergenic
Database links

Mature sequence cbr-miR-2

Accession MIMAT0029606
Sequence

61 - 

uaucacagccagcuuugaugugc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1