Stem-loop sequence cbr-mir-247

AccessionMI0024742 (change log)
DescriptionCaenorhabditis briggsae miR-247 stem-loop
Stem-loop
   --         -  c     g    a  -  a 
5'   agaguucag ac cuggu accu ca gc g
     ||||||||| || ||||| |||| || ||  
3'   ucucgaguc ug gauca ugga gu cg u
   cc         g  a     g    -  a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 10093683-10093743 [+]
intergenic
Database links

Mature sequence cbr-miR-247

Accession MIMAT0029605
Sequence

40 - 

ugacuagagugcugagcucucc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1