Stem-loop sequence ipu-mir-457b

AccessionMI0024713 (change log)
DescriptionIctalurus punctatus miR-457b stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention ipu-mir-457b
(2 sentences)

Stem-loop
   --u         -uca         gcu    uc 
5'    agcagcaca    auauuggca   gccc  u
      |||||||||    |||||||||   ||||  c
3'    ucgucgugu    uaugaccgu   uggg  c
   ucc         uuug         ---    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-457b

Accession MIMAT0029577
Sequence

1 - 

uagcagcacaucaauauuggca

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1