Stem-loop sequence ipu-mir-7575

AccessionMI0024710 (change log)
DescriptionIctalurus punctatus miR-7575 stem-loop
Literature search

1 open access papers mention ipu-mir-7575
(3 sentences)

Stem-loop
   --g    gu       a  gu   g 
5'    caug  caugauc ug  cau a
      ||||  ||||||| ||  |||  
3'    guac  guacuag ac  gua u
   ccg    ag       c  ag   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7575

Accession MIMAT0029574
Sequence

1 - 

gcauggucaugaucaugguc

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1