Stem-loop sequence ipu-mir-7556

AccessionMI0024688 (change log)
DescriptionIctalurus punctatus miR-7556 stem-loop
Literature search

1 open access papers mention ipu-mir-7556
(1 sentences)

Stem-loop
   --a    a              c ug  - a 
5'    uugu uucaaguuacugua g  ua c a
      |||| |||||||||||||| |  || |  
3'    aaca aaguucaaugacau c  au g g
   ugc    g              a cu  a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7556

Accession MIMAT0029552
Sequence

40 - 

uacaguaacuugaagacaacgu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1