Stem-loop sequence ipu-mir-7147

AccessionMI0024672 (change log)
DescriptionIctalurus punctatus miR-7147 stem-loop
Gene family MIPF0001705; mir-7147
Literature search

1 open access papers mention ipu-mir-7147
(1 sentences)

Stem-loop
   --u    c        a       u aaa 
5'    guac augcuggu gccagua g   u
      |||| |||||||| ||||||| |    
3'    cgug ugcgacca uggucgu c   a
   ccc    u        a       u ggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7147

Accession MIMAT0029536
Sequence

1 - 

uguaccaugcugguagccagu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1