Stem-loop sequence ipu-mir-9-5

AccessionMI0024663 (change log)
DescriptionIctalurus punctatus miR-9-5 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention ipu-mir-9-5
(5 sentences)

Stem-loop
   --uc               g     -  au 
5'     uuugguuaucuagcu uauga gu  u
       ||||||||||||||| ||||| ||  u
3'     aagccaauagaucga auacu ca  u
   auga               a     u  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-9

Accession MIMAT0029528
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1