Stem-loop sequence ipu-mir-9-7

AccessionMI0024662 (change log)
DescriptionIctalurus punctatus miR-9-7 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention ipu-mir-9-7
(5 sentences)

Stem-loop
   -uc       a       g     guua 
5'    uuugguu ucuagcu uauga    u
      ||||||| ||||||| |||||    g
3'    aagccaa agaucga auacu    a
   uga       g       a     auaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-9

Accession MIMAT0029528
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1