Stem-loop sequence ipu-mir-9-2

AccessionMI0024658 (change log)
DescriptionIctalurus punctatus miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention ipu-mir-9-2
(5 sentences)

Stem-loop
   --uc               g     g  u c 
5'     uuugguuaucuagcu uauga ug g u
       ||||||||||||||| ||||| || |  
3'     aagccaauagaucga auacu gc c g
   auga               a     -  - g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-9

Accession MIMAT0029528
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1