Stem-loop sequence ipu-mir-456

AccessionMI0024635 (change log)
DescriptionIctalurus punctatus miR-456 stem-loop
Gene family MIPF0000341; mir-456
Stem-loop
   --    g     uu       acau ug   cc 
5'   gcag caucu  ccagucu    g  gau  a
     |||| |||||  |||||||    |  |||   
3'   uguu guaga  ggucgga    c  cug  g
   ac    g     uu       ---- gu   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-456

Accession MIMAT0029514
Sequence

41 - 

caggcugguuagaugguuguca

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1