Stem-loop sequence ipu-mir-365-1

AccessionMI0024626 (change log)
DescriptionIctalurus punctatus miR-365-1 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   -     c           -----    u   a 
5'  aggga uuuuaggggca     gcug guu u
    ||||| |||||||||||     |||| ||| a
3'  uuccu aaaauccccgu     ugac cag c
   a     a           aauac    c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-365

Accession MIMAT0029507
Sequence

1 - 

agggacuuuuaggggcagcu

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1