Stem-loop sequence ipu-mir-29b

AccessionMI0024610 (change log)
DescriptionIctalurus punctatus miR-29b stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --     a            ca    -  auu 
5'   gcuga uucagauggugc  uaga gu   u
     ||||| ||||||||||||  |||| ||    
3'   ugacu aaguuuaccacg  aucu cg   u
   ug     a            --    a  gua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-29b

Accession MIMAT0029493
Sequence

1 - 

gcugaauucagauggugccauaga

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1