Stem-loop sequence ipu-mir-29c

AccessionMI0024609 (change log)
DescriptionIctalurus punctatus miR-29c stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --         c      gu      -g  uu 
5'   cugguuuca auggug  uuagau  ug  c
     ||||||||| ||||||  ||||||  ||   
3'   gacuaaagu uaccac  gaucug  ac  u
   gu         u      --      aa  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-29c

Accession MIMAT0029492
Sequence

1 - 

cugguuucacauggugguuuaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1