Stem-loop sequence ipu-mir-26b

AccessionMI0024603 (change log)
DescriptionIctalurus punctatus miR-26b stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   --uu         c         -----    u 
5'     caaguaauc aggauaggu     uagu c
       ||||||||| |||||||||     ||||  
3'     guucauugg ucuuauccg     auca c
   cuuu         u         gcaug    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-26b

Accession MIMAT0029486
Sequence

1 - 

uucaaguaauccaggauagguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1