Stem-loop sequence ipu-mir-26a-2

AccessionMI0024600 (change log)
DescriptionIctalurus punctatus miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   --uu         ca         gu ug 
5'     caaguaauc  ggauaggcu  c  u
       |||||||||  |||||||||  |   
3'     guucauuag  cuuauccgg  g  c
   ucac         ua         ag uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-26a

Accession MIMAT0029485
Sequence

1 - 

uucaaguaauccaggauaggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1