Stem-loop sequence ipu-mir-22b

AccessionMI0024590 (change log)
DescriptionIctalurus punctatus miR-22b stem-loop
Gene family MIPF0000053; mir-22
Stem-loop
   -------    -     u       -u   g 
5'        uuca cuggc agcuuua  gug c
          |||| ||||| |||||||  |||  
3'        aagu gaccg ucgaaau  cac a
   ugucgag    u     -       uc   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-22b

Accession MIMAT0029480
Sequence

33 - 

aagcugccaguugaagagcugu

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1