Stem-loop sequence ipu-mir-22a

AccessionMI0024589 (change log)
DescriptionIctalurus punctatus miR-22a stem-loop
Gene family MIPF0000053; mir-22
Stem-loop
   --         -      a      u  ccuug 
5'   aguucuuca cuggca gcuuua gu     u
     ||||||||| |||||| |||||| ||      
3'   ucaagaagu gaccgu cgaaau cg     g
   ug         c      -      -  accau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-22a

Accession MIMAT0029479
Sequence

42 - 

aagcugccagcugaagaacugu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1