Stem-loop sequence ipu-mir-223

AccessionMI0024588 (change log)
DescriptionIctalurus punctatus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Stem-loop
   ga              gugguu       gau 
5'   guauuugacagacu      gacacuc   c
     ||||||||||||||      |||||||   u
3'   cauaaacuguuuga      cuguggg   a
   -c              ------       gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-223

Accession MIMAT0029478
Sequence

1 - 

gaguauuugacagacugugg

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1