Stem-loop sequence ipu-mir-20a

AccessionMI0024566 (change log)
DescriptionIctalurus punctatus miR-20a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ---ua           g     g   uauuu 
5'      aagugcuuaua ugcag uag     c
        ||||||||||| ||||| |||      
3'      uucacgagugu acguc auc     u
   ugaag           g     -   uacug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-20a

Accession MIMAT0029462
Sequence

38 - 

acugcagugugagcacuugaagu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1