Stem-loop sequence ipu-mir-199a-4

AccessionMI0024549 (change log)
DescriptionIctalurus punctatus miR-199a-4 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   -c       u        c   u   gg g 
5'   ccagugu cagacuac ugu cag  c u
     ||||||| |||||||| ||| |||  | a
3'   gguuaca gucugaug aca guu  g g
   uu       c        -   u   -a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-199a-5p

Accession MIMAT0029450
Sequence

1 - 

cccaguguucagacuaccuguuc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ipu-miR-199a-3p

Accession MIMAT0031093
Sequence

40 - 

acaguagucugcacauugguu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1