Stem-loop sequence ipu-mir-196d-2

AccessionMI0024546 (change log)
DescriptionIctalurus punctatus miR-196d-2 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   --    ga    -     a   gcu  g 
5'   ccaa  aaca aagac acu   aa u
     ||||  |||| ||||| |||   ||  
3'   gguu  uugu uuuug ugg   uu g
   cg    -g    a     a   -au  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-196d

Accession MIMAT0029449
Sequence

31 - 

uagguaguuuuauguuguugggc

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1