Stem-loop sequence ipu-mir-196a-1

AccessionMI0024543 (change log)
DescriptionIctalurus punctatus miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   --u          a          auu    
5'    agguaguuuc uguuguuggg   ggc 
      |||||||||| ||||||||||   || u
3'    uccgucaaag acaacagcuc   ccu 
   agu          a          ggu    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-196a

Accession MIMAT0029448
Sequence

1 - 

uagguaguuucauguuguuggga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1