Stem-loop sequence ipu-mir-194a

AccessionMI0024542 (change log)
DescriptionIctalurus punctatus miR-194a stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   --u         a      g       uu 
5'    guaacagca cuccau uggaagg  u
      ||||||||| |||||| |||||||   
3'    cguugucgu gaggug accuucu  g
   gug         c      -       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-194a

Accession MIMAT0029447
Sequence

1 - 

uguaacagcaacuccaugugga

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1