Stem-loop sequence ipu-mir-184

AccessionMI0024536 (change log)
DescriptionIctalurus punctatus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   --        c      a c     uauccau 
5'   ccuuauca uuuucc g ccagc       u
     |||||||| |||||| | |||||        
3'   ggaauagu aagagg c gguug       u
   cg        c      - a     cuuauga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-184

Accession MIMAT0029441
Sequence

42 - 

uggacggagaacugauaagggc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1