Stem-loop sequence ipu-mir-181c

AccessionMI0024533 (change log)
DescriptionIctalurus punctatus miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ipu-mir-181c
(4 sentences)

Stem-loop
   -ca         cug          uuau 
5'    cauucauug   ucgguggguu    c
      |||||||||   ||||||||||     
3'    guaaguaac   ggccgcucag    u
   aga         --a          cuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-181c

Accession MIMAT0029438
Sequence

1 - 

cacauucauugcugucggugggu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1