Stem-loop sequence ipu-mir-181b-1

AccessionMI0024532 (change log)
DescriptionIctalurus punctatus miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ipu-mir-181b-1
(4 sentences)

Stem-loop
   --a          cug    u     ua  cu 
5'    acauucauug   ucgg ggguu  gu  u
      ||||||||||   |||| |||||  ||   
3'    uguaaguaac   aguc cucga  ca  g
   caa          --a    u     --  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-181b

Accession MIMAT0029437
Sequence

1 - 

aacauucauugcugucgguggg

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1